Review



p tet promoters  (Biofab Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Biofab Inc p tet promoters
    P Tet Promoters, supplied by Biofab Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p tet promoters/product/Biofab Inc
    Average 90 stars, based on 1 article reviews
    p tet promoters - by Bioz Stars, 2026-03
    90/100 stars

    Images



    Similar Products

    p tet promoter  (Addgene inc)
    93
    Addgene inc p tet promoter
    P Tet Promoter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p tet promoter/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    p tet promoter - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier
    tet responsive promoter p tight  (Addgene inc)
    92
    Addgene inc tet responsive promoter p tight
    Tet Responsive Promoter P Tight, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tet responsive promoter p tight/product/Addgene inc
    Average 92 stars, based on 1 article reviews
    tet responsive promoter p tight - by Bioz Stars, 2026-03
    92/100 stars
    		  Buy from Supplier
    promoter p xyl teto  (Addgene inc)
    92
    Addgene inc promoter p xyl teto
    Bacterial strains and plasmids used in this study.
    Promoter P Xyl Teto, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/promoter p xyl teto/product/Addgene inc
    Average 92 stars, based on 1 article reviews
    promoter p xyl teto - by Bioz Stars, 2026-03
    92/100 stars
    		  Buy from Supplier
    p tet promoter  (TaKaRa)
    86
    TaKaRa p tet promoter
    Bacterial strains and plasmids used in this study
    P Tet Promoter, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p tet promoter/product/TaKaRa
    Average 86 stars, based on 1 article reviews
    p tet promoter - by Bioz Stars, 2026-03
    86/100 stars
    		  Buy from Supplier
    tet responsive p hcmv 1 promoter  (TaKaRa)
    86
    TaKaRa tet responsive p hcmv 1 promoter
    Bacterial strains and plasmids used in this study
    Tet Responsive P Hcmv 1 Promoter, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tet responsive p hcmv 1 promoter/product/TaKaRa
    Average 86 stars, based on 1 article reviews
    tet responsive p hcmv 1 promoter - by Bioz Stars, 2026-03
    86/100 stars
    		  Buy from Supplier
    p tet tight promoter system  (TaKaRa)
    86
    TaKaRa p tet tight promoter system
    Bacterial strains and plasmids used in this study
    P Tet Tight Promoter System, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p tet tight promoter system/product/TaKaRa
    Average 86 stars, based on 1 article reviews
    p tet tight promoter system - by Bioz Stars, 2026-03
    86/100 stars
    		  Buy from Supplier
    p tight tet responsive promoter  (TaKaRa)
    86
    TaKaRa p tight tet responsive promoter
    Bacterial strains and plasmids used in this study
    P Tight Tet Responsive Promoter, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p tight tet responsive promoter/product/TaKaRa
    Average 86 stars, based on 1 article reviews
    p tight tet responsive promoter - by Bioz Stars, 2026-03
    86/100 stars
    		  Buy from Supplier
    p tet promoters  (Biofab Inc)
    90
    Biofab Inc p tet promoters
    Bacterial strains and plasmids used in this study
    P Tet Promoters, supplied by Biofab Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p tet promoters/product/Biofab Inc
    Average 90 stars, based on 1 article reviews
    p tet promoters - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    tetracycline-inducible promoters p tet  (Biofab Inc)
    90
    Biofab Inc tetracycline-inducible promoters p tet
    Bacterial strains and plasmids used in this study
    Tetracycline Inducible Promoters P Tet, supplied by Biofab Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tetracycline-inducible promoters p tet/product/Biofab Inc
    Average 90 stars, based on 1 article reviews
    tetracycline-inducible promoters p tet - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Bacterial strains and plasmids used in this study.

    Journal: Microbial Cell

    Article Title: GFP fusions of Sec-routed extracellular proteins in Staphylococcus aureus reveal surface-associated coagulase in biofilms

    doi: 10.15698/mic2023.07.800

    Figure Lengend Snippet: Bacterial strains and plasmids used in this study.

    Article Snippet: pRMC2 , E. coli / S. aureus shuttle plasmid with inducible promoter P xyl/tetO . Amp r , Cm r . pRMC2 was a gift from Tim Foster Addgene ( http://n2t.net/addgene:68940 ; RRID:Addgene_68940). , [ ] .

    Techniques: Derivative Assay, Methylation, Plasmid Preparation, Sequencing

    Bacterial strains and plasmids used in this study

    Journal: AMB Express

    Article Title: Development of butanol-tolerant Bacillus subtilis strain GRSW2-B1 as a potential bioproduction host

    doi: 10.1186/2191-0855-1-10

    Figure Lengend Snippet: Bacterial strains and plasmids used in this study

    Article Snippet: P Tet promoter , P Tet -F , gcag GCATGC (SphI)GTTCAACAAACGGGCCATAT , pHY300PLK, Takara Bio Inc, Japan.

    Techniques: Plasmid Preparation, Clone Assay, Expressing

    Primers and source of sequence

    Journal: AMB Express

    Article Title: Development of butanol-tolerant Bacillus subtilis strain GRSW2-B1 as a potential bioproduction host

    doi: 10.1186/2191-0855-1-10

    Figure Lengend Snippet: Primers and source of sequence

    Article Snippet: P Tet promoter , P Tet -F , gcag GCATGC (SphI)GTTCAACAAACGGGCCATAT , pHY300PLK, Takara Bio Inc, Japan.

    Techniques: Sequencing